Yeast Genomic Courseware- Beta 1 . 1

In order for this web page to function correctly, the cached version must be reloaded
Please click here to reload


A. Preface

The genomic data base is a new scientific paradigm. Looking back a decade, it was scarcely imaginable that the totality of a species elemental wisdom would be known, let alone beautifully packaged, and free for all to see! Amongst the genre so displayed, none is more elegant than the first of the eukaryotes - the yeast that makes our bread and wine. Fascination with rising dough and inebriants pales to the enchantment of a global display of life’s victuals. There is much here for many to enjoy. Our purpose is to gain a wider audience for SGD and the data bases that will follow in its wake. Devotees are well served by SGD and those steeped in molecular biology find their mark. The uninitiated need help. For example, the contribution of second division segregation and contig assembly to chromosome cartography are not greatly enlightened by commonplace exposure to the three factor cross.

Yeast Genomic Courseware attempts to illustrate the three levels of genetic intelligence used by SGD: genetic map; physical map; and DNA sequence. Illustration is by way of reference to original publications and integration by way of SGD's elegant interface. It is my belief that future pedagogy must integrate genomics into the undergraduate curriculum. Hopefully this courseware will allow students to move with confidence to myriad additional levels of inquiry based on genomic data bases.

B. Overview

The objective of this courseware is to provide an historical treatment of the genetic and physical maps of Saccharomyces cerevisiae as a prelude to the determination of the chromosomal DNA sequence - the fundamental genomic structure. Throughout the courseware we will interact with the Saccharomyces Genome Database SGD Home and in the process become familiar with SGD's interface software. Peruse the SGD-linked animation to get an overview of our proposed electronic pilgrimage. Animation Overview


C. Introduction

There is a natural pedagogy in SGD design. SGD, a creature of the net, is best served by subservience to its logic. An electronic text would be a sluggish and distanced format for SGD’s delightful immediacy. Unlike textual structure, data base structure is the archetype, with exemplars mere clicks away. Our instruction is meant to prance to the surface, move to the side and patiently coach by relevant queries. On occasion we tunnel below SGD to converse with original heroes; textual treatment here is meant to inform without pedantry, and to be intimately related to data base structure. SGD is based on the DNA sequence of the common food yeast Saccharomyces cerevisiae which is used to leaven your bread and ferment your wine. Saccharomyces cerevisiae's biological and genomic-celebrity status is given below.

C1. What are yeasts?

C2. History

The construction of the Saccharomyces cerevisiae genome data base is the result of a far-reaching international effort. Decades of genetic, physiological and molecular analyses preceded the concerted international effort to complete the DNA sequence. The completion of the data base is tribute to the cooperative interaction of a multitude of scientists.

International team completes DNA sequence of yeast:

Of the 6000 genes identified in 1996, the function of only % ? was known
D. SGD Home Page

SGD ’s home page is the frontispiece for a vast cornucopia of biological information. As a guide to relevant topics SGD windows will be indicated by SGD Windows , with to indicate relevant links.

From the SGD Home Page Help Glossary
Gene_class refers to a ? letter gene symbol

D1. SGD flavours

A taste for the range of SGD information is seen from some of the windows showing information on GAL4 , a regulatory gene involved in the utilization of galactose.

Genomic view - position of GAL4 open reading frame (ORF) on chromosome 16.

GAL4 DNA sequence - DNA sequence of the ORF. %%

Protein Similarity View Protein Similarity View- positions on the 16 yeast chromosomes of ORFs with homology to Gal4.

Sacch3D - the quaternary structure of the Gal4 protein binding to DNA

E. Vocabulary

Yeast aficionados have their own variation of genetic jargon. It's very precise and logical; well , they think so! In any event we can't understand SGD until we learn some of the lingo.

SGD Home Page Help SGD glossary

An ORF is a stretch of DNA that would code for a protein of at least amino acids ?

SGD Home Page Gene Registry, Gene Naming Guidelines Genetic symbols

  1. The gene name should consist of three italicized letters, (the gene symbol) followed by an italicized integer (e.g. arg1 for arginine auxotroph gene1 (locus1). Alleles are designated by the gene name followed by - integer; e.g. -236.
    The first auxotrophic allele of arg1 is designated as ?
    Dominant alleles of the gene (most often wild-type) are denoted by all UPPERCASE letters, while recessive alleles are denoted by all lowercase letters.

  2. The 3-letter gene symbol should stand for a description of a phenotype, gene product or gene function. WILD TYPE and first mutant alleles of the first adenine auxotrophic locus are ? WILD TYPE and second mutant alleles of the seventh sporulation locus are ? loci. In addition, a given gene symbol should have only one associated description, i.e., all genes which use a given 3-letter symbol should have a related phenotype, gene product or gene function.
SGD Home Gene Registry Gene Name Lists Expanded TEXT Given Names
Alternative gal4 name ? , how many gal loci ?, which gal loci involved in metabolism gal1, gal7, , and ?; transport, ?; regulation; gal4, gal11, gal3, gal83 and ?

F. Genomic View

SGD Home Maps Genomic View (Features Map)

This first view of the genome presents each chromosome as a red horizontal bar. A very few genetic markers are placed on the chromosomes as it would be impossible to list them all. Note that as you drag the arrow across the chromosome, the DNA coordinates, in bp from the left telomere, are given. The length of tiny chromosome 1 is ? bp; chromosome 4 is ?bp. Click on CEN1, the two ORFs that flank CEN1 are ? and ? , TFC3 is on the ? strand, YAR002W is on the ? strand, the ORF closest to the left and right telomeres are ? and ?
SGD Home Maps Genomic View (Physical and Genetic Map)

Another CEN1 view shows that genes can be mapped in more than one way. NTG1 has been only ? mapped, let1 has been only ? mapped, and ade1 has been ? mapped.

Genomic View Autotutorial Hot Tip- 3:

SGD Home Help Hot Tips Displaying Genomic Sequences

The chromosome 1 sequence report found in Proc. Natl. Acad. Sci. USA. 1995. Vol. 92 : 3809-3813, contains ? ORFS , ? tRNAs, 15-kbp telomeric redundant sequence is reminiscent of ?

Ste5 protein functions in the ? pathway, and the chromosomal DNA coordinates are 658343 to ?; the ORF adjacent to the right telomere of chromosome IV is at coordinates 1526317 to ?, and its function is ? protien.

G. Life Cycle of Yeast

The number of chromosomes in haploid cells is ?, diploid cells ?; the two mating types of haploid cells are alpha and ? ; the spindle orientations at anaphase II ? or ?, result in any specific placement of the four ascospores in the ascus, meiosis produces ? haploid gametes (spores) - two of genotype alpha, and two of genotype ? ; cells in the haploid cycle are either alpha or ? genotype whereas cells in the diploid cycle are of ? genotype.

H. Genetic Maps by Recombination Frequency

The genetic maps detailed under Genomic View provided the first approximate positioning of genetic landmarks. Genetic maps are based on the identification of mutants and observation of the recombinant frequency in gametes produced by meiosis. Since all the four products of meiosis are contained in an ascus the primary method of analysis is the tetrad analysis. It may be useful to review meiosis and tetrad analysis in your favourite genetics text prior to proceeding.

H1. First and Second Division Segregation

Review meiosis paying particular attention to;
  1. separation of two homologous centromeres at anaphase I ( stage of first division segregation of CEN-linked genes) and
  2. splitting, and subsequent separation, of each of the homologous centromeres at anaphase II ( stage of second division segregation of CEN-linked genes).
Thus in this review note that the final animation shows first division segregation of ‘D/d' and second division segregation of ‘A/a'

In Saccharomyces cerevisiae the four products of meiosis, ascospores, are enclosed within a sac-like structure called an ascus. [SGD-life cycle] When these four ascospores are isolated, and the genotypes of each determined, the resultant tetrad analysis can be used to map genes. In the case of a single heterozygote, such as ADE1 / ade1, the expectation is 2 ADE1 : 2 ? spores. This 2 : 2 segregation is evidence that a single genetic locus is responsible for the phenotype being studied.

Normally the four ascospores of the first and second meiotic divisions are not constrained (placed) in the ascus in any recognizable way. Thus it is not possible to determine if alleles separated (segregated) from each other at the first or second meiotic division. When alleles separate from each other at the first meiotic division there has not been a cross-over of sister chromatids between the allele and the centromere (CEN) - called first division segregation.

Thus first division tetrads contain four non cross-over gametes. If there has been a cross-over between the allelic pair and CEN, the two alleles will segregate from each other at the second meiotic division - called second division segregation. Second division tetrads contain two non cross-over gametes and two cross-over gametes.

The cross-over (recombinant) gametes result from a single cross-over between the gene and its CEN. In the meiosis review, note how the first division segregation of ‘D/d' vs the second division segregation of ‘A/a' is dependent on a cross-over between ‘A/a' and the centromere. The one cross-over of a second division tetrad results in ?% cross-over (recombinant) and ?% non cross-over (parental) gametes.

One tetrad of an ADE1 / ade1 heterozygote showed first division segregation and one tetrad showed second division segregation. The number of non cross-over gametes is ? and the number of cross-over gametes is ?. The % cross-over gametes = ?.

The fundamental rule of mapping states that 1 % cross-over gametes = 1 map unit (centiMorgan - cM). Gene- CEN distance can be determined as 1/2 the % of second division tetrads. Thus

cM = 1/2 ( % of second division segregation.)

One tetrad from ADE1 / ade1 showed first division segregation and one tetrad showed second division segregation. The frequency of cross-over gametes is ? or %?. Using cM = 1/2 ( % of second division segregation), the ADE1-CEN 1 distance = 1/2 ( )? cM or cM?

H2. CEN Mapping via Linear Asci

In a founding contribution to yeast genetics, Donald Hawthorne selected special yeast strains with linear asci.

Hawthorne, D.C. 1955. The use of linear asci for chromosome mapping in Saccharomyces. Genetics 40: 511-518.

"On the basis of genetic evidence, it was concluded that the nuclear distribution in the linear four-spored asci of a diploid Saccharomyces hybrid follows a definite pattern with the alteration of spores with non-sister nuclei in the ascus. A cytological investigation of the distribution during meiosis also indicated that there was an alternation of non-sister nuclei in the elongated ascogenous cell . Thus, a deviation from the alternation of the dominant and recessive characters in the scoring of these asci also indicates the occurrence of a crossover and gives a simple and direct means to determine the linkage of a gene to the centromere of its chromosome.

From the analysis of 74 linear asci of the diploid hybrid, the gene for tryptophane independence was mapped at about 2.5 units from the centromere, a value which was confirmed independently in tetraploid material. Evidence is also given that the mating type locus is approximately 27 units from the centromere. The genes for melibiose and galactose ( G-2) fermentation, histidine, uracil, and methionine independence did not show linkage."

He found that the spores in the linear ascus were placed in the ascus in a particular order related to the first and second meiotic divisions. The two homologous centromeres of the first division, CEN i and CEN i i, come to rest in the centre of the ascus.

At this stage the two homologous CENs have been partitioned into two different nuclei. In the absence of a cross-over between CEN and an heterozygous site (e.g., TRP1 / trp1), the two alleles would also have undergone first division segregation.

The spindles of the second meiotic division overlap

so that the final distribution of daughter CENs is CEN i , CEN i i, CEN i, CEN i i

First division segregation of CEN - linked alleles would be ? , whereas patterns of ? or ? or ? are patterns of second division segregation.

The latter three patterns result from a cross-over between TRP1/ trp1 and CEN4. The map distance can be determined by cM = ? ( % of 2nd div.seg).

Hawthorne observed one TRP1, TRP1, trp1, trp1; one TRP1, trp1, trp1, TRP1; two trp1, TRP1, TRP1, trp1 and seventy TRP1, trp1, TRP1, trp1 asci. The distance between TPR1and CEN4 is ?cM

H3. Gene Mapping using CEN-linked Markers

The closest CEN-linked genetically mapped marker for chromosome 1 is ?

Genomic View Physical and Genetic Map CEN1

Note:Physically, but not genetically mapped ORF's such as NTG1, have not been mapped by tetrad analysis. Several markers (trn1, FUN24, TFC3, ssal, tpd3, let1) are presented as closely centromere linked. Clicking on these markers and reviewing the linkage values reveals that tpd3 is the closest CEN1 linked marker. However, the limitations of genetic analysis indicate that 1-2 cM differences in linkages are not likely statistically significant. The exercise below will familiarize you with CEN addresses throughout the genome. The closest CEN-linked markers for chromosomes 2-16 are?

2 ? , 3 ?, 4 ?, 5 ? , 6 ? , 7 ?, 8 ?, 9 ?, 10 ?, 11 ?, 12 ?, 13 ?, 14 ?, 15 ?, 16 ?

Subsequent detailed trisomic analyses showed a trp1 second division segregation frequency of 0.0050 or a CEN4-trp1 distance of cM ?
Absolute trp1 second division segregation

For all practical purposes the close linkage of trp1 to CEN4 precludes a cross-over in the trp1 - CEN4 interval. Other closely linked CEN markers can be used in the same way.

When one marker, such as trp1, is essentially completely linked to its CEN, a second CEN-linked marker can be mapped without the necessity of linear tetrads. Several such analyses resulted in an ade1- CEN distance calculation of 4 cM. In these analyses the second division segregation of ade1 is identified by the observation of an ascus containing 4 spore types ( tetratype ascus). In a TRP1 ade1 by trp1 ADE1 cross there are three possible types of asci:
parental ditype PD; [] ?
non parental genotype NPD [ ] ?;
tetratype TT [] ?.
PD and NPD result from first division segregation whereas TT results from second division segregation.

CEN1-ade1-241mapping data, %? second division tetrads were observed.

SGD Home Search SGD ADE1 Submit, Mapping_data

Which of the two listed distance calculations, trn1- ade1-1673 [ cM = 4.2 ] vs trn1- CEN1 [ cM = 0.5 ], required a known CEN linked marker such as trp1? ? How would you determine the trn1- ade1-1673 distance? Why are the nine CEN1 - ade1 listed map distances different ?

H4. Mapping of Linked Genes

If two genes are linked to each other, the map distance between them can be calculated according to the following formula.

cM = 50 [ (TT + 6 NPD) ] / [ ( PD + NPD + TT ]

This formula assumes only zero, one or two crossovers in a map interval. The distances calculated by this formula vary slightly from SGD values due to SGD's use of a mathematical model.

Consider a cross between two haploid strains carrying two different chromosome 1 linked genes, such as strain 1: flo1 and strain 2: cdc15.

SGD Home Maps Genomic View Physical and Genetic Map right arm
The diploid genotype would be ? For linked genes, PD tetrads
[] ? are in excess of NPD tetrads
[] ?, and the frequency of TT tetrads
? varies with the extent of marker linkage. formula / mathematical model values for the archived cdc15-flo1-242 cM are: ?

SGD Home Page Physical and Genetic Map FLO1 Mapping_data

H5. Unlinked Genes

If two genes are not linked the expectation is a PD:NPD:TT of 1:1:4. This is the case whether the genes are on the same or different chromosomes. 60 tetrads in a cross of ade1 by trp1 would occur in a frequency of 10 PD []; ?
10 NPD []; ?
40 TT []; ?

H6. Linkage problems

I. Physical Map

As seen above the genetic map has a lot of limitations. Not all loci can be expected to give an observable phenotype thus leaving portions of the map without markers. Recombination frequencies vary from one cross to another and are influenced by both genetic and environmental factors. Rather like a city map with missing streets and known streets of slightly different lengths. Physical maps bypass the biological process of meiosis and rely only on some measure of the actual physical distance along the chromosome. The first approximate physical map was based on the production of restriction endonuclease fragments and the determination of fragment size in agarose gels. The ordering of overlapping fragments produced larger and larger maps until a complete chromosomal contig was produced. Contigs also had shortcomings but increased map resolution well beyond the genetic map and provided the basis for the final map - the DNA sequence. We'll get an overview of physical map structure prior to a study of the details of contig assembly

I1. Tutorials

I1a. Autotutorial
An historical treatment of contig construction used to construct the physical map begins below under "Cloning the Yeast Genome". An overview of the general nature of the physical map use is given in the autotutorial SGD's Hot Tip #4. Make good use of the HELP button in the upper right corner ; its very friendly, and likely answers more questions than you envision !
SGD Home Help Hot Tips Viewing the Combined Physical and Genetic Maps


I1b. Your own tutorial

Mosey through the three windows of Genomic View. Remember that HELP is upper right with description, glossary and, for the adventurous, links to other parts of the galaxy. Focus on the CEN1 region, as we will oft journey there.
Genomic View
Physical and Genetic Map
Features Map
Physical Map


I1c. Wow, but how?

Recall the general problem; 12,000,000 bp of DNA partitioned over 16 chromosomes. Four possible base pairs at each of 12,000,000 positions - the random probability is 4 to the power of ? . A review of recombinant DNA technology may be useful at this stage. Topics of interest include restriction endonucleases, agarose separation of DNA fragments, vectors and cloning.

I2. Cloning the yeast genome

A general strategy for cloning the yeast genome was first proposed by Olson et al. in 1986. Their objective was to develop a convenient strategy to position contiguous overlapping fragments of chromosomal DNA. The component fragments of the map were to be located by the positioning of restriction endonuclease sites. If this could be done for all sixteen chromosomes the resultant global restriction map would subsequently be used for more detailed genomic analyses such as DNA sequencing.

Olson, M et al. 1986. Random-clone Strategy for Genomic Restriction Mapping in Yeast. Proc. Natl. Acad. Sci. USA 83: 7826-7830.
SGD Home Yeast community Information Search SGD colleagues Publishes_As

As a test of the general principles involved they produced a contig map of a 110 kb segment. Lambda cloning vectors were used that lacked EcoRI (R) and HindIII (H) restriction sites. Total yeast DNA was partially digested with ‘4-cutter' restriction endonucleases MboI or SmaIIIA to yield a population of overlapping DNA fragments with CTAG overhangs. The fragments were cloned into lambda vectors to yield a genomic library presumed to carry all of the chromosomal DNA. The average size of the cloned DNA fragment was 15 kb.

Since no attempt was made to select or fractionate the DNA fragments prior to cloning, the resultant library contained a random collection of genomic fragments

I3. Ordering Library Fragments

They expected to have cloned any given segment of the chromosome approximately 4.5 times "... sampling of approximately 95% of the genome with an average redundancy of at least 4.5". How many lambda clones did they make ? How could they identify, and order, overlapping clones!?

They digested individual clones with R and H. RH double digests produced fragments of a convenient size; other digests would have worked also. RH digests from individual clones were run on agarose gels to determine RH fragment sizes. All fragments ranging in size from 400 to 7500 bp were identified and used in a subsequent mapping strategy. For example consider the restriction fragments from clones 3299 and 4473 as seen in Fig. 2 of their publication.

Clone fragments are given successive numbers from the largest to smallest size. The smallest 3299 RH fragment is numbered ? and the largest 4477/3299 fragment is numbered ?. Clone 3299 produced 15 RH fragments and clone 4473 produced ? RH fragments. Although some fragments appear unresolved in the reproduction shown in Fig.2 ( e.g., fragments ? and ? ) , Olson et al (1986) saw fragment separation in the original gels.

First let's determine what we can about the relationship of clone 3299 and clone 4473 fragments. They made the assumption that if two clones had 5 or more identical fragments, the two clones must overlap. Does this seem reasonable to you or would you have preferred more common fragments? The calculated fragment sizes are given in Fig. 3A of Olson el al. (1986).

Fragment-size lists

															
Fragment number  1    2    3         4    5    6    7   8   9  10  11  12  13  14  15  16  17  18  19  20
 Clone 4473     2032 2029 1483      1245 1205 1087 917 877 813 802 739 698 679 626 536 535 531 436 436 413
 Clone 3299     2021 2021 1472 1264 1237 1215 1083 909     812     745     669     527 524 523 437
Fragment number	 1    2    3    4    5    6    7    8       9      10      11      12  13  14  15
Pairwise Comparison of RH Fragments From Clones 4473 and 3299
(Olson, M.V. et al. 1986. Proc. Natl. Acad. Sci. USA 83:7826-7830, Fig. 3A)

Note that the sizes of presumed identical fragments are not listed as being the same size. For example, fragment 1 of clone 4473 is ? bp and fragment 1 of clone 3299 is ? bp. Such small differences were deemed to result from statistical variation in the calculation of fragment sizes, and not due to real differences in fragment sizes. They determined that clones 3299 and 4473 had ? fragments in common. In addition, fragment number ? of clone 3299, and fragments ? of clone 4473, were unique to their respective clones.

Thus clones 3299 and 4473 define three fragment groups: one end group containing fragment 4 of 3299, the middle group of 14 paired fragments, and the end group with six 4473 fragments. They note that fragments within a group are unordered whereas the groups are ordered relative to each other.

I4. Contig Maps

Clone RH maps are drawn where (i) group boundaries extend above and below a horizontal line and (ii), RH fragment boundaries within a group are indicated by a vertical line above a horizontal line. Within a group, RH fragments are mapped from left to right in decreasing size. Given the fragment sizes for clones 3299 and 4473

Fragment-size lists

															
Fragment number  1    2    3         4    5    6    7   8   9  10  11  12  13  14  15  16  17  18  19  20
 Clone 4473     2032 2029 1483      1245 1205 1087 917 877 813 802 739 698 679 626 536 535 531 436 436 413
 Clone 3299     2021 2021 1472 1264 1237 1215 1083 909     812     745     669     527 524 523 437
Fragment number	 1    2    3    4    5    6    7    8       9      10      11      12  13  14  15
Pairwise Comparison of RH Fragments From Clones 4473 and 3299
(Olson, M.V. et al. 1986. Proc. Natl. Acad. Sci. USA 83:7826-7830, Fig. 3A)

the contig map for clones 3299 and 4473 is

Consider

Arrow 1 points to a ? boundary; arrow 2 points to ? boundary; is ? or ? .

The 3299/4473 two-clone contig is not very informative since the positioning of left and right end groups is arbitrary, and there are many unordered fragments within two different groups. However, Olson, M et al.(1986) used RH digests of many intervening clones to produce a detailed contig map of a 110 kb region of chromosome 5. A short seven years passed, and Riles, L et al. (1993) published on the use of the RH technique to construct contigs of the six smallest yeast chromosomes.

Riles, L et al. 1993. Physical Maps of the Six Smallest Chromosomes of Saccharomyces cerivisiae at a Resolution of 2.6 Kilobase Pairs. Genetics 134: 81-150.
SGD Home Yeast community Information Search SGD colleagues Publishes_As

An appreciation of their contribution can be seen in the contig map of the 230,195 bp chromosome 1

Note that twenty-two numbered prime clones (3029 ...4599) encompass the entire chromosome. However, the confident positioning of prime clones required the analysis of many intervening clones.

Consider the placement of prime clones 3128 (RH map), 4239 (RH map), 4236 (RH map) in correct order

Additional clone *A allows the connection ? and clone *B allows the connection ?. Chromosome 1 coordinates for Olson/Riles prime clones are archived by SGD.

SGD Home Help Directory Anonymous FTP OlsonRestMap olson frag data.chrI

Chromosome 1 coordinates for prime clone 5084 are 114851 to ? and prime clone 3128 ranges from nucleotide 122616 to ?

Compare and contrast the RH restriction data of clones 5084 and 3128; the largest common restriction fragment marked # is ? bp.

I4a. Limitations of the contig map

As mentioned above, the order of fragments within a group is unknown. We do not know whether the fragments are the result of cutting at EcoRI or HindIII sites. Thus a given fragment may result from R R; R H; H R; or ? flanking restriction endonuclease sites. Furthermore, the chromosomal coordinates are subject to experimental error. Recall from above ".... the sizes of presumed identical fragments are not listed as being the same size. For example, fragment 1 of clone 4473 is 2032 bp and fragment 1 of clone 3299 is 2021 bp . Such small differences were deemed to result from statistical variation in the calculation of sample sizes, and not due to real differences in fragment sizes." Consequently the recorded values are the result of a statistical procedure.

The cumulation of many small size errors over hundreds of thousands of base pairs would be expected to give other than an exact record of the chromosomal base pair coordinates. Other problems with agarose gel analyses include failure to observe multiple similar-sized fragments and running small fragments off the agarose gel.

The average resolution of the contig map is only 2.6 Kbp which is only ?

of the nucleotide-based map. Nevertheless the contig map encompasses the total genome and provides a level of resolution sufficient for many purposes. It will serve as the anchor for the ultimate physical map - the genomic DNA sequence.

J. ORF Shop

Prime clones are available from ATCC. Imagine you wanted to obtain DNA that contained the chromosome 1CEN1-linked locus spo7. The chromosome 1 coordinates for spo7 pre 135852 to 136631. You would order ATCC clone ?, which corresponds to Riles clone 3128 and spo7 is found on EcoR1 restriction fragments of 3116 and bp. ?
SGD Home Maps Genomic View Physical Map spo7 70124 Olson_Rest_Data 3128and 70124

The cost of ATCC 70124 to a US profit institution is ? US$

K. Combined Physical and Genetic maps

As noted above, construction of the genetic map was initiated in 1955 whereas physical map protocols first appeared in 1986 with the final determination of the 12 Mb genomic sequence realized in 1996. Genetic maps depend on the fortuitous identification of mutant phenotypes and are not expected to cover all chromosomal locations. Indeed many cases are known where gene disruptions do not result in any identifiable mutant phenotype.

In general, the mapping of genetic markers preceded the generation of the physical map. When genetically mapped genes had been cloned and sequenced it became of interest to place their ORFs on the physical map. One example of this is found in a publication on the CEN1 region by Clark, M.W. et al. 1994.

Clarke, M.W. et al. 1994. Sequencing of Chromosome I of Saccharomyces cerevisiae : Analysis of the 42 kbp SPO7-CEN1-CDC15 Region. Yeast 10: 535-541.

SGD Home Yeast community Information Search SGD colleagues Publishes As
A summary of their work is found in Fig.1 of their publication.

A comparison of published DNA sequences with their chemically determined 42,000 bp sequence allowed the positioning of ten previously sequenced genes ( spo7, trn1, EFB1, ssa1, TFC3, RFA1, TGA1, ade1, KIN3, cdc15 ) and nine new ORFs. The resolving power of the physical map is evident from the discovery of unusual genetic structure. One of the nine new ORFs had the unusual feature of being a tentative antisense gene that may regulate expression of a larger gene.

Antisense gene ? may regulate locus ssa1 by production of a complementary RNA. The YAL004 ORF is on the ? strand and ssa1 is on the ? strand. The tentative nature of this assignment is evident from "...would require additional evidence to achieve the status of a boni fide gene" .

SGD Home Maps Genomic View CEN1 Features Map (CEN1)

News release on antisense technology: Technology Puts DNA to Work to Fight Disease-Causing Genes

K1. Genetic Distance vs. Physical Distance Ratios - cM/Kbp

Genetic maps are relatively inaccurate since they are constructed from the frequency of cross-over gametes which is influenced by a number of factors such as sample size and genetic background. See nine CEN1-ade1 distances under Gene Mapping Using CEN Linked Markers above. In contrast, physical maps are very reproducible and accurate to the level of adjacent base pairs - 3.6 A°. The physical map error rate has been calculated as being less than 3 incorrect nucleotides in 10,000 bases. Nevertheless there is a good general correspondence between the physical and genetic map although a perusal of the combined genetic and physical maps shows that the relationship is far from linear.

SGD Home Maps Physical and Genetic Maps Combined Physical and Genetic Maps

The parameter cM / Kbp describes the relationship between the physical and genetic map. It is evident that the rate of cross-over is not constant along the length of the chromosome.

SGD Home Help Maps Combined Physical and Genetic Maps I, II, III....XVI lower window Chromosome 1 Genetic Distance vs Physical Distance Ratios

Scan the Genetic Distance vs. Physical Distance Ratios for several chromosomes. Can you formulate any general observations and supporting hypotheses to explain the non linear response? Are there any anomalies related to values of the cM / Kbp ratio? The cM / Kbp in the tpd3 region of chromosome 1 is approximately minus ? !? Meiotic cross-over frequency is higher near the ? or ? telomere of chromosome XII.

L. On the Mechanism of Genetic Recombination

Current evidence suggests that a physical cross-over between non-sister chromatids in meiosis is initiated by a double-strand break in the DNA of one of the two chromatids. Until very recently a general method for location of the double-strand breaks was lacking. A recent publication by F. Baudat and A. Nicolas (1997) has identified the likely location of these meiotic double-strand breaks in chromosome 3. Figure 2 from their publication suggests that the breaks occur mainly in the ?or ?
regions of the chromosome. How does this conclusion influence your conclusions on the lack of linearity for the parameter cM/Kbp?

M. DNA Sequence of Olson / Riles Clones

The cM of the genetic map was replaced by the restriction endonuclease site of the contig map. Although contig resolution of 2.6 Kbp (9390 A°) greatly exceeds that of the genetic map the cartography is not complete. Ultimate resolution of the physical map is 3.6 A°, the distance between adjacent nucleotides. Recall that the average yeast chromosomal DNA insertion size in an Olson/Riles clone is 15000 bp.

If DNA sequence runs are ca 300 bp, the number of dideoxy DNA sequence analyses required for both strands of one insert of DNA of an Olson/Riles clone is ? Similarly the number of DNA sequence analyses required for both DNA strands of the total 12000000 bp genome is ?. To facilitate the large workload of genomic sequencing, specific chromosomes were assigned to an international group of scientists.

SGD Directory Lists and Tables Systematic Sequencing Table

In general, Olson / Riles clones for specific chromosomes were subcloned into vectors designed to facilitate DNA sequencing ; the chromosomal DNA sequence was determined, and forwarded to SGD for archiving.

M1. LTE1-SPO7 region of chromosome 1

An early example of genomic sequence determination via Olson / Riles clones is found in a publication of Ouellette et al. (1993).

The LTE1-SPO7 region of chromosome 1 falls within the domain of prime clones 9218, 5084 and 3218.

However, the three clones give limited resolution of the region. For example, consider the four small fragments within the right-hand group of 5084 that are shared by 3128 . These fragments, sized by agarose gel electrophoresis, are placed in descending sizes of 589, 545, 430 and ?bp but are unordered in relation to each other.

SGD Home Help Directory Anonymous FTP OlsonRestMap Olson frag data.chrI
The ? restriction endonuclease sites that delimit these four fragments may be either EcoRI (R) or HindIII (H). Thus we do not know if the 426 bp fragment truly resides at the right-hand terminus of 5084 or at one of the other ? positions within the 5084 right-hand group boundary. Furthermore we don't know if the 426 bp fragment is flanked by RR, RH, HR or HH restriction endonuclease sites. Further resolution of Olson/Riles fragments entailed subcloning and DNA sequencing protocols.

M2. DNA Sequencing Vector

Vector pBluescript SK (+) was used to subclone complete-digest EcoRI fragments from clones of the LTE1-SPO7 regime. pBluescript has ? EcoRI site within the synthetic multiple cloning site (MCS)

whereas subclones have ?EcoRI sites flanking the yeast chromosomal DNA insert. Restriction mapping of pBluescript subclones resulted in the selection of six subclones which contained DNA of the entire area. Sequential ordering of the six subclones within the region is found in Fig.1 of Ouellette et al. (1993).

The positioning of the subclones pLF183, pLF184, pLF185, pLF179, pLF180, pLF181 increases resolution by directly defining ? sites and thus ? sites by extrapolation. However, the exact positioning of EcoRI, HindIII and other restriction endonuclease sites followed from sequence analysis of fragment DNA inserted into a variety of subclones.

Details of subcloning and sequence protocols are housed in laboratory notes and vary considerably amongst laboratories and the fragments being analyzed. A feel for DNA sequence technology can be found in the Methods section of Ouellette el al (1993).

DNA manipulation

The 32 kb region of CH I presented in this work is from a series of six contiguous EcoRI fragments cloned from three overlapping lambda clones into the Blue Script KS(+) plasmid (Stratagene). The cloning strategy is described in A. Barton and D.B. Kaback (in preparation) using standard molecular techniques (Sambrook et al. 1989). DNA was sequenced using the USB Sequenase kit, following the protocols recommended by the supplier. Sequencing was done on single-stranded DNA as outlined in Clark et al. (1992) using the sequencing apparatus described by Lang and Burger (1990). Plasmids, marked in Fig. 1, were sequenced using one of the two strategies we adopted. PLF179, pLF180, pLF181, and pLF183 were subcloned and sequenced using the standard M13 and BlueScript primers, and custom designed primers were made so that each strand would be sequenced at least once. Alternatively, as was the case for pLF184 and pLF185, the lambda DNA was first subcloned into smaller fragments (3-5 kb), before these were subjected to unidirectional nested deletions using the "Erase-a-Base System" from Promega. The complementary strand was then sequenced with designed primers. The sequence of pLF184 was previously reported by us (Clark et al. 1992) and part of YAL010 was previously reported by Whyte et al. (1990). To confirm the continuity of the DNA between adjacent plasmids, direct sequencing of the parent lambda clone was conducted with the Circumvent Thermal Cycle Dideoxy DNA Sequencing kit, using the protocol provided by the supplier (New England Biolabs). All oligonucleotides were synthesized on a Pharmacia Gene Assembler Plus using standard phosphoramidite chemistry, as outlined by the supplier. Primer design was facilitated with the public domain version of the Oligo program of Rychlik and Rhoads (1980).

M3. Genomic Sequence via Contiguous Overlaps

Dideoxy sequencing technology conveniently determines base sequence over a length of 3 - 400 nucleotides. Thus the general strategy for total genomic sequence requires the identification of small adjacent segments by DNA sequence overlap. When all contiguous sequences are ordered the entire chromosomal sequence will have been determined.

As an example consider a scenario for the determination of the sequence of the EcoRI fragment cloned into PLF181 - found left of the spo7 locus Agarose gel analysis of this fragment determined a size of approximately 960 bp, in excess of the 3 - 400 bp capacity of the sequencing technology.

When the EcoRI fragment was digested with HindIII it was cleaved into two fragments of approximately 420and 540 bp. These two EcoRI - HindIII fragments were subcloned into the MCS of pBluescript to produce recombinant plasmids of 3.4 and 3.5 Kbp; named pBluescript3.4 and pBluescript3.5. The recombinant pbluescript3.4 and pBluescript3.5 were processed for DNA sequence determination using the T3 and T7 primers; ergo four sequence analyses ( 3. 5 -T3, 3. 5 -T7, 3. 4 -T3, 3.4 -T7 )

Let **........... indicate an unspecified number of bases; all queries require an input of four nucleotides [AGCT].

The T3 primed reactions produced a 5' primer -MCS sequence of ATTAAC ? .................................. ? AAGCTTHindIII followed by ca 3 - 400 bp of PLF181 sequence.

The T7 primed reactions produced a 5' primer- MCS sequence of AATACG ? ..................... ? GAATTCEcoRI followed by ca 3 - 400 bp of PLF181 sequence.

The four dideoxy DNA sequences determined were:

1. 3.4 - T3 primer: ATTAAC....................AAGCTTHindIII T CTTTGAAACT ACTGACACCC ..............TTTCTCCAAT TGCTGTGCAT .......

2. 3.4 -T7 primer: AATACG....................GAATTCEcoRI C CTCAGCAATA CACCTGCAAA.............TTATACTCCG ATGCACAGCA .........

3. 3.5 - T3 primer: ATTAAC......................AAGCTTHindIII AAA CGTTTTAACG TGCTATTTTC..........TTGGCAACCATTATTCGGCC........

4. 3.5 - T7 primer: AATACG.....................GAATTCEcoRI AGAT CCGGTACATT TTCGTGCAGT............. GGCCGAATAATGGTTGCCAA ........

Note: Without reference to the flanking sequences the orientation of the 960 bp EcoRI is unknown. We don't know if 5'-AGAT or 5'- ? is closest (proximal) to the left telomere

Assuming that 3.5 - T7 primer: AATACG.....................GAATTCEcoRI defines the Watson strand of the left telomere - proximal sequence, the Watson strand sequence is: 5'- GAATTCEcoRIAGAT CCGGTACATT TTCGTGCAGT .......GGCCGAATAA TGGTTGCCAA..... ? ATAGCACGTTAAAACG TTTAAGCTTHindIII ? TGAAACT ACTGACACCC ..............TTTCTCCAAT TGCTGTGCAT ? GTATAA..........TTTGCAGGTG TATTGCTGAGGGAATTCEcoRI

N. Inaugural Chromosome Sequence

Chromosome 3 was sequenced in 1992. [ Oliver, S.G. et al. 1992. The complete DNA sequence of yeast chromosome III. Nature 357: 38-46] Search SGD Author Oliver* This classic publication resulted from the collaborative work of 147 scientists from 37 different laboratories. In an inspired effort, the world wide cooperation of other groups Systematic Sequencing Table completed the genomic sequence by 1996.

Oliver's prophetic comment "The complete sequence of the yeast genome will open up new areas of molecular genetics and establish a foundation for the interpretation of sequence data from higher organisms"has become a reality. Browse through the Genetics Virtual Library to gain some appreciation of sweeping applications throughout the biological kingdom.

Content: Dr. Gerry Rank rank@sask.usask.ca
Animations: Zhuan Chen zhc134@mail.usask.ca
Graphics: Dennis Dyck dyckj@sask.usask.ca
Html and Javascript: Gordon Holtslander holtslander@sask.usask.ca
Last Modified Thursday, 23-Feb-2006 10:45:47 CST